-
Notifications
You must be signed in to change notification settings - Fork 1
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
129 changed files
with
14,387 additions
and
0 deletions.
There are no files selected for viewing
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,85 @@ | ||
import * as regression from 'https://cdn.skypack.dev/d3-regression'; | ||
import * as d3 from 'https://cdn.skypack.dev/d3'; | ||
|
||
export function plotActors(actors, talentWeight, looksWeight, minimum) { | ||
|
||
actors = transpose(actors).map(v => ({ | ||
talent: v.x, | ||
looks: v.y, | ||
fame: v.x * talentWeight + v.y * looksWeight | ||
})); | ||
|
||
const w = 600; | ||
const h = 470; | ||
const result = d3.create("svg").attr("width", w).attr("height", h); | ||
const margin = 20; | ||
const xScale = d3.scaleLinear().domain([-2, 2]).range([margin, w - margin]); | ||
const yScale = d3.scaleLinear().domain([-2, 2]).range([h - margin, margin]); | ||
const points = result | ||
.append("g") | ||
.selectAll("circle") | ||
.data(actors) | ||
.join(enter => { | ||
const sel = enter | ||
.append("circle") | ||
.attr("r", 3) | ||
.attr("cx", d => xScale(d.talent)) | ||
.attr("cy", d => yScale(d.looks)) | ||
.attr("fill", d3.lab(50, 40, 20)); | ||
return sel.filter(d => d.fame <= minimum) | ||
.attr("fill", "rgb(200, 200, 200)") | ||
.attr("r", 2); | ||
}); | ||
|
||
const linearRegression = regression.regressionLinear() | ||
.x(d => d.talent) | ||
.y(d => d.looks) | ||
.domain([-2, 2]); | ||
|
||
const chosenActors = actors | ||
.filter(d => d.fame > minimum); | ||
|
||
const line = result | ||
.append("g") | ||
.append("line") | ||
.attr("stroke", d3.lab(20, 40, 20)) | ||
.attr("stroke-width", 1.5) | ||
.datum(linearRegression(chosenActors)) | ||
.attr("x1", d => xScale(d[0][0])) | ||
.attr("x2", d => xScale(d[1][0])) | ||
.attr("y1", d => yScale(d[0][1])) | ||
.attr("y2", d => yScale(d[1][1])); | ||
|
||
|
||
const xAxis = d3.axisBottom(xScale).ticks(3); | ||
result.append("g") | ||
.attr("transform", `translate(0, ${yScale(0)})`) | ||
.call(xAxis); | ||
|
||
result.append("text") | ||
.attr("x", xScale(0.05)) | ||
.attr("y", yScale(2)) | ||
.text("Looks"); | ||
|
||
result.append("text") | ||
.attr("y", yScale(0.1)) | ||
.attr("x", xScale(-2)) | ||
.text("Talent"); | ||
|
||
const yAxis = d3.axisLeft(yScale).ticks(3); | ||
result.append("g") | ||
.attr("transform", `translate(${xScale(0)}, 0)`) | ||
.call(yAxis); | ||
|
||
return result.node(); | ||
} | ||
|
||
function transpose(df) { | ||
const keys = Object.keys(df); | ||
return df[keys[0]] | ||
.map((v, i) => Object.fromEntries(keys.map(key => [key, df[key][i] || undefined]))) | ||
.filter(v => Object.values(v).every(e => e !== undefined)); | ||
} | ||
|
||
|
||
|
Large diffs are not rendered by default.
Oops, something went wrong.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,84 @@ | ||
--- | ||
title: "Progress" | ||
subtitle: "**Daniel Fürth**<br> Assistant professor<br> SciLifeLab/Uppsala University<br><br>🔗 [furthlab.xyz](https://furthlab.xyz)<br>[{{< fa brands twitter size=1xl >}} @furthlab](https://furthlab.xyz)" | ||
format: | ||
revealjs: | ||
slide-number: true | ||
chalkboard: | ||
buttons: false | ||
preview-links: auto | ||
logo: ../assets/img/SciLifeLab_Logotype_Green_POS.png | ||
css: styles.css | ||
footer: Friday 15 Sep | ||
height: 1048 | ||
width: 1600 | ||
resources: | ||
- demo.pdf | ||
--- | ||
|
||
## <span style="font-size: 0.7em;">📚🙇🏽♀️🙇🏻♂️📖 Agenda </span> | ||
|
||
<style> | ||
.sm { | ||
font-size: 0.75em; | ||
} | ||
.sm2 { | ||
font-size: 0.5em; | ||
} | ||
</style> | ||
|
||
::: {.sm} | ||
::: incremental | ||
Topics for today: | ||
|
||
- **🧬 FluoroProx probes**: | ||
- Status figures. | ||
- Figure 01 | ||
- Supplementary Figure 1 | ||
- Figure 2? | ||
- Supplementary Figure 2 | ||
- **🧬 Photolitography:** | ||
- New synthesis route | ||
- Janelia Dyes? | ||
- 2photon microscope | ||
::: | ||
::: | ||
|
||
::: footer | ||
::: | ||
|
||
# FluoroProx probes - _fig. 1_ | ||
<img src="../assets/img/fig01_cMycMax.jpg"> | ||
|
||
# FluoroProx probes - _Supp.fig. 1_ | ||
<img src="../assets/img/fig_S01_synthesis.png"> | ||
|
||
# FluoroProx probes - _Fig. 2_ ? | ||
<img src="../assets/img/EMSA.png"> | ||
|
||
- [Recombinant human c-Myc protein (Active) (ab169901)](https://www.abcam.com/products/proteins-peptides/recombinant-human-c-myc-protein-active-ab169901.html) | ||
- [Recombinant Human MAX protein (ab95309)](https://www.abcam.com/products/proteins-peptides/recombinant-human-max-protein-ab95309.html) | ||
|
||
Oligonucleotide: | ||
`GATCAGTTGACCACGTGGTCTGGG` | ||
|
||
Suggestion: `/56-FAM/GATCAGTTGACCACGTGGTCTGGG/3AmMO/` | ||
|
||
- [5' 6-FAM (Fluorescein) `/56-FAM/`](https://eu.idtdna.com/site/catalog/modifications/product/1108) | ||
- [3' Amino Modifier `/3AmMO/`](https://eu.idtdna.com/site/catalog/modifications/product/3299) | ||
|
||
# Cleavable biotin linkers | ||
|
||
[PC-Biotin-PEG4-NHS carbonate](https://broadpharm.com/product/bp-23108) | ||
|
||
<img src="https://broadpharm.com/web/images/mol_images/BP-23108.gif" width=50%> | ||
|
||
[Disulfide Biotin Alkyne](https://broadpharm.com/product/bp-40312) | ||
|
||
<img src="https://broadpharm.com/web/images/mol_images/BP-40312.gif" width=80%> | ||
|
||
# FluoroProx probes - _Supp.Fig. 2_ | ||
|
||
# New synthesis route | ||
|
||
<img src="../assets/img/new_synthesis.png"> |
7 changes: 7 additions & 0 deletions
7
presentations/20230915/index_files/libs/clipboard/clipboard.min.js
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
1 change: 1 addition & 0 deletions
1
presentations/20230915/index_files/libs/quarto-html/light-border.css
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
6 changes: 6 additions & 0 deletions
6
presentations/20230915/index_files/libs/quarto-html/popper.min.js
Large diffs are not rendered by default.
Oops, something went wrong.
1 change: 1 addition & 0 deletions
1
presentations/20230915/index_files/libs/quarto-html/quarto-html.min.css
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
203 changes: 203 additions & 0 deletions
203
presentations/20230915/index_files/libs/quarto-html/quarto-syntax-highlighting.css
Some generated files are not rendered by default. Learn more about how customized files appear on GitHub.
Oops, something went wrong.
Oops, something went wrong.