Merge branch 'crispr' into dev_bjorn

src/pydna/crispr.py

@@ -0,0 +1,128 @@
+#!/usr/bin/env python3
+# -*- coding: utf-8 -*-
+
+# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
+# This code is part of the Python-dna distribution and governed by its
+# license.  Please see the LICENSE.txt file that should have been included
+# as part of this package.
+"""Provides the Dseq class for handling double stranded DNA sequences.
+
+Dseq is a subclass of :class:`Bio.Seq.Seq`. The Dseq class
+is mostly useful as a part of the :class:`pydna.dseqrecord.Dseqrecord` class
+which can hold more meta data.
+
+The Dseq class support the notion of circular and linear DNA topology.
+"""
+
+from abc import ABC, abstractmethod
+import re
+from pydna.utils import rc
+
+
+class _cas(ABC):
+    scaffold = "ND"
+    pam = "ND"
+    size = 0
+    fst5 = 0
+    fst3 = 0
+
+    def __init__(self, protospacer):
+        self.protospacer = protospacer
+        self.compsite = re.compile(
+            f"(?=(?P<watson>{protospacer}{self.pam}))|(?=(?P<crick>{rc(self.pam)}{rc(protospacer)}))", re.UNICODE
+        )
+
+    @abstractmethod
+    def search(self, dna, linear=True):
+        """To override in subclass."""
+        pass
+
+    def __repr__(self):
+        return f"{type(self).__name__}({self.protospacer[:3]}..{self.protospacer[-3:]})"
+
+    @abstractmethod
+    def __str__(self):
+        """To override in subclass."""
+        pass
+
+
+class cas9(_cas):
+    """docstring.
+
+         |----size----------|
+
+         ---protospacer------
+                          -fst3
+         fst5             |-|
+         |--------------|
+                             PAM
+    5-NNGGAAGAGTAATACACTA-AAANGGNN-3
+      ||||||||||||||||||| ||||||||
+    3-NNCCTTCTCATTATGTGAT-TTTNCCNN-5
+        ||||||||||||||||| |||
+      5-GGAAGAGTAATACACTA-AAAg-u-a-a-g-g  Scaffold
+        ---gRNA spacer---    u-a
+                             u-a
+                             u-a
+                             u-a
+                             a-u
+                             g-u-g
+                            a    a
+                             g-c-a
+                             c-g
+                             u-a
+                             a-u
+                            g   a  tetraloop
+                             a-a
+    """
+
+    scaffold = "GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG"
+    pam = ".GG"
+    size = 20
+    fst5 = 17
+    fst3 = -3
+    ovhg = fst5 - (size + fst3)
+
+    def search(self, dna, linear=True):
+        """docstring."""
+        dna = str(dna).upper()
+        if linear:
+            dna = dna
+        else:
+            dna = dna + dna[1 : self.size]
+        results = []
+        for mobj in self.compsite.finditer(dna):
+            w, c = mobj.groups()
+            if w:
+                results.append(mobj.start("watson") + 1 + self.fst5)
+            if c:
+                results.append(mobj.start("crick") + len(self.pam) + 1 - self.fst3)
+        return results
+
+    def __str__(self):
+        """docstring."""
+        return f">{type(self).__name__} protospacer scaffold\n{self.protospacer} {self.scaffold}"
+
+
+def protospacer(guide_construct, cas=cas9):
+    """docstring."""
+    in_watson = [
+        mobj.group("ps")
+        for mobj in re.finditer(f"(?P<ps>.{{{cas.size}}})(?:{cas.scaffold})", str(guide_construct.seq).upper())
+    ]
+    in_crick = [
+        rc(mobj.group("ps"))
+        for mobj in re.finditer(f"(?:{rc(cas.scaffold)})(?P<ps>.{{{cas.size}}})", str(guide_construct.seq).upper())
+    ]
+    return in_watson + in_crick
+
+
+if __name__ == "__main__":
+    import os as _os
+
+    cached = _os.getenv("pydna_cached_funcs", "")
+    _os.environ["pydna_cached_funcs"] = ""
+    import doctest
+
+    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
+    _os.environ["pydna_cached_funcs"] = cached

tests/test_module_crispr.py

@@ -0,0 +1,37 @@
+#!/usr/bin/env python
+# -*- coding: utf-8 -*-
+
+import pytest
+
+
+def test_crispr():
+    from pydna.crispr import cas9, protospacer
+    from pydna.dseqrecord import Dseqrecord
+    from pydna.dseq import Dseq
+
+    a = Dseq.from_representation(
+        """\
+    GTTACTTTACCCGACGT
+    CAATGAAATGGGCTGCA
+    """
+    )
+
+    b = Dseq.from_representation(
+        """\
+    CCCaGG
+    GGGtCC
+    """
+    )
+
+    containing_sgRNA = Dseqrecord("GTTACTTTACCCGACGTCCCgttttagagctagaaatagcaagttaaaataagg")
+
+    target = Dseqrecord("GTTACTTTACCCGACGTCCCaGG")
+
+    assert [f.seq for f in target.cut([cas9(ps) for ps in protospacer(containing_sgRNA)])] == [a, b]
+    assert [f.seq for f in target.cut([cas9(ps) for ps in protospacer(containing_sgRNA.rc())])] == [a, b]
+    assert [f.seq for f in target.rc().cut([cas9(ps) for ps in protospacer(containing_sgRNA)])] == [b.rc(), a.rc()]
+    assert [f.seq for f in target.rc().cut([cas9(ps) for ps in protospacer(containing_sgRNA.rc())])] == [b.rc(), a.rc()]
+
+
+if __name__ == "__main__":
+    pytest.main([__file__, "-vv", "-s"])